"5 Personalities of Mine That I Wish Did Not Exist"

by Doctor Dolittle

in Completed Works

< '"GATCAATCAGGTCAGACCTGATTGATC///Hairpin Genome"' by Doctor Dolittle
> 'I'm Not Gay, I Swear It!' by Doctor Dolittle

Description

Apr 12th 2008
Tags:
available cartoon concept expressive not
Views:
102
Comments:
7
Score:
1
Favorites:
4
Well, I'm not going to claim to have MPD or anything, I'm just going to say that I have a very "multifaceted" personality. And sometimes I think I would be better-off if some of those facets didn't exist. These are the ones that I would be pleased to get rid of (from left to right). Lord knows why I felt the need to name them, but it just seemed like the right thing to do. PS: They're more like moods, actually, and I can safely say that everyone has moods... even though I'm the only person that really fancied naming them.

General Bomberger (pronounced "BOM-ber-zjay"): The side of me that really loves war movies. Especially WWI and WWII... The General gets all excited and goes nuts during combat scenes. Sometimes I think it's made entirely out of testosterone.

Oksar Milde: A weird, sordid Oscar Wilde knock-off. Pseudopoetic, loud, and obnoxious with a passion for room-clearing filibusters. Seriously. When I get this one on, I can talk and talk and talk and talk. This is actually how I am, most of the time.

An Owl: A part of me that is an owl. Hoot.

The Closet-Case: That little part of me that's sort of gay. It comes out when I complain about colour-schemes, people's clothes, curtains, and various other aesthetic things. Also, I can consider this the piece that would make me fall to my knees for Oscar Wilde.

The Skad-Father (pronounced like "Godfather"): Well, my dad once made the joke that he'd be proud of me if I decided to go into the mafia. I would be proud of me if I could MAKE IT into the mafia. But I always said I would found my own and call it the "Skafia." But I digress. The Skad-Father is the part of me that will go after anyone that messes with my friends. It's also the part of me that likes to party like a madman.

Really, I don't have a generic personality. I've sort of got a different brain everyday. But no matter what, I'm still Alistaire.

PS: Leave a comment before you rate down. I get rather flustered at the druts that just rate down without telling me why.

Comments

KGAM4342 Says:

The owl is fantastic.

SaRaH ExPLoSioN Says:

OWL.

Xriinova Says:

That owl has some sexy, sexy eyes.
Wow, your art is awesome. I love the style!

Nanook Says:

Let's tighten up our lines a little bit, shall we?
Mmm hmm, that needs some work.
But the art is cool...
Oddly, I too have this visions of characters in my head, which can be manipulated to solve my various issues.

AN OWL, HOW QUEER

LAEluu Says:

HOOOTHOOOOT.

tobywashere Says:

Why does everyone comment about the owl? Poor General Bomberger...

Eve ok Says:

I like the gay personality.
More than I should
:I